Jra3 Protocols For dna extraction From Bone and Tissue Protocols For Preparation of dna extracts For ngs



Download 89.96 Kb.
Date conversion23.04.2018
Size89.96 Kb.
JRA3

Protocols For DNA Extraction From Bone and Tissue

Protocols For Preparation of DNA Extracts For NGS
The protocols that follow have been successfully applied to various materials (bone, soft tissue, exoskeleton) from different locations (Europe, Caribbean, Arctic) and ranging in age from 100-50,000 years old. It should however be noted that protocols are constantly being revised and improved and that the specific protocols applied can be highly dependent on the samples under investigation and the nature of the research undertaken. For further information on additional protocols, from setting up an ancient DNA laboratory to phylogenetic analyses, see Shapiro and Hofreiter (2012).
Preparation: In order to limit DNA contamination occurring during laboratory processing of the sample, DNA extraction and pre-PCR protocols are best carried out in a dedicated ancient DNA laboratory. This room should be physically isolated from the PCR laboratory, preferably in a separate building. Protocols for the daily operation of an ancient DNA lab are discussed in (Shapiro and Hofreiter, 2012; Cooper and Poinar 2000) and include:

(1) cleaning of surfaces, utensils and equipment with bleach/UV prior to use.

(2) use of protective clothing to stop tracking of DNA into the lab.

(3) working within a laminar flow hood or glove box to provide a clean space.

(4) including negative extraction and PCR controls alongside samples to improve detection of contaminants.

Extraction Protocol Bone
This protocol can be applied to bone powder of between 10–60mg. PrediCtoR (JRA1 York) should be used as a guide to assess the extent of DNA preservation, and may therefore inform on the appropriate weight of bone powder. It should be noted that the relationship between sample preservation, and the amount of starting material to use is not well characterised, and that while micro-sampling (10mg) is feasible for well preserved materials, it may be insufficient for older/less well preserved samples.
Bone powdering:
There are two main powdering techniques:

(1) pulverization, using a shaking bead in a bone mill.

(2) Directly drilling into the sample.
In both cases prevention of cross-sample contamination should be addressed. The bone powdering area should be separate/enclosed from the PCR set up area. The area and equipment used (shaking beads/containers and drill/drill bits) must be changed/cleaned with bleach/UV prior to use with each new sample to be powdered.

When using the direct drilling approach the drill should be used in short bursts at a slow speed. This is to prevent the drill bit from heating, the heat generated has been found to significantly decrease the DNA yield (Adler et al. 2011).


Incubation:
To demineralize bone and lyse cells.
Place each sample (bone powder) into a screw top tube and add the following reagents to each sample.

For every 5 samples extracted include a control (blank) extraction.




Reagent

Volume (L)

Final conc.

Ethylenediaminetetraacetic acid (EDTA) (0.5M)

440

0.44M

Urea (1M)

50

0.1M

Proteinase K (20 mg/mL)

10

0.4 mg/mL

Incubate the samples overnight at 560C with gentle rotation.




Silica-based Spin Column Extraction:
To extract purified DNA using QIAquick PCR purification kits (Qiagen).
Sedimentation:

To separate the supernate from any remaining bone material. Remove samples from the incubator and centrifuge for 5 minutes at 1000 rpm.


Concentration:

Concentrate the DNA using an ultrafiltration membrane. Transfer the supernatant (up to 600L) into a Vivaspin column (500 MWCO). Centrifuge for 2 minutes at maximum speed. A maximum of 120L should remain in the filter column, centrifuge for longer if required.


Binding DNA to a silica membrane:

Per sample set up a 2mL tube containing 600L PB buffer. The buffer contains a high concentration of chaotropic salts that aid adsorption of nucleic acids to silica.

Transfer 120L (maximum) from the Vivaspin filter column into the PB buffer and briefly vortex the solution.

Transfer 720L of the sample solution into a silica-based spin column.

Centrifuge for 1 minute at maximum speed.
Removing impurities:

Transfer the inner column into a new collection tube and add 720L of PE buffer. The buffer contains ethanol to wash away salts and other impurities.

Centrifuge for 1 minute at maximum speed.

Transfer the inner column into a new collection tube.

Centrifuge for 1 minute at maximum speed (dry spin to remove any residual ethanol from the PE buffer).
Elute DNA:

Transfer the inner column into a DNA free tube.

Elution step: add 50L of EB. Wait for 5 minutes.

Centrifuge for 1 minute at maximum speed.

Repeat the elution step and centrifuge for 1 minute at maximum speed.

Transfer the total extract (100L) into a screw top tube.

Add Tween-20 (final concentration 0.05%) to the extract to aid longer-term viability.
Extracts should be stored at -200C.
Extraction Protocol Tissue
Using QIAamp DNA Micro extraction kit (Qiagen).

For every 5 samples extracted include a control (blank) extraction.


The process follows the same main principles as outlined above for DNA extraction from bone. When extracting DNA from tissue use the tissue extraction protocol as stated in the Qiagen handbook, adding the following modifications:

Include the optional carrier RNA to increase yield from degraded samples.

At the elution step add 50L of AE buffer and wait for 5 minutes before centrifuging for 1 minute. Then repeat this step.

Transfer the total extract (100L) into a screw top tube.

Add Tween-20 (final concentration 0.05%) to the extract to aid longer-term viability.
Extracts should be stored at -200C.
Library Building Protocol
This protocol can be applied to DNA extracted through either of the aforementioned methods and to PCR products. The protocol is a JRA2 (Mainz laboratory) modified version of the methods described in Meyer and Kircher (2010). Note, there is no fragmentation step due to the (already) fragmented nature of ancient/degraded DNA samples.

For every 5 libraries constructed include a control (blank) library.


50L of template DNA is required.
Production of Adapter Mix:
The adapter mix can be prepared in advance and used repeatedly when stored at -200C.


Required Oligonucleotides

Oligo Name

Sequence 5’ – 3’

IS1

A*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T

IS2

G*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T

IS3

A*G*A*T*CGGAA*G*A*G*C

IS4

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT

A * indicates a PTO bond.


Assemble reactions for the P5 mix and the P7 mix in separate PCR tubes.



P5 Mix

Volume (L)

Final conc.

Primer IS1

30

200 M

Primer IS3

30

200 M

Oligo hybridization buffer (10x)

7.5

1x

Water

7.5




Total

75






P7 Mix

Volume (L)

Final conc.

Primer IS2

30

200 M

Primer IS3

30

200 M

Oligo hybridization buffer (10x)

7.5

1x

Water

7.5




Total

75



Incubate the reactions in a thermal cycler: 950C for 10 seconds, then a ramp from 950C to 120C at a rate of 0.10C/sec.


Combine the reactions to obtain the adapter mix (150L; 100M each adapter).
Blunt end repair:
To remove or fill in any overhanging 5’ or 3’ ends of the fragmented double stranded DNA.

Prepare a master mix of the reagents below for the number of reactions required.

All enzymes should remain on ice. Once prepared do not vortex the master mix, use a pipette to combine reagents.


Reagent

Volume (L)

Final conc.

Water

7.12




T4 Ligase Buffer (10x)

7

1x

dNTPs (each 25mM)

0.28

100M each

BSA (10mg/mL)

0.7

0.1mg/mL

T4 PNK (10U/L)

3.5

0.5 U/L

T4 DNA polymerase (5 U/L)

1.4

0.1 U/L

Total

20



Pipette 20L of master mix into a PCR tube and then add 50L of DNA extract. Total per sample 70L.


Incubate in a thermal cycler for 250C for 15 minutes, followed by 5 minutes at 120C and a final inactivation step of 750C for 10 minutes.
Adapter Ligation:
To attach adapters P5 and P7 to the DNA fragments.

Prepare a master mix of the reagents below for the number of reactions required.

All enzymes should remain on ice. The master mix can be vortexed, but prior to the addition of the DNA ligase.


Reagent

Volume (L)

Final conc.

Water

14.5




ATP (100mM)

0.5

0.5mM

PEG-4000 (50%)

10

5%

T4 DNA Ligase (5 U/L)

2.5

0.125 U/L

Total

27.5



Add 2.5L of pre-prepared adapter mix (P5 and P7) to each sample. The total volume/sample is 72.5L.

Pipette 27.5L of master mix into the PCR tube containing the combined adapter mix and sample. The total volume/sample is 100L.
Incubate at 220C for 30 minutes.
Purification Step:
Use MiniElute PCR Purification Kit:

Add 200L PB Buffer to samples (total volume/sample is 300L). Transfer to column and spin for 1 minute.

Add 650L PE Buffer into the column and spin for 1 minute.

Dry spin for 1 minute.

Elute using 22L of warm EB Buffer.
Adapter Fill In:
To fill in any gaps or nicks created by the adapter ligation step.

Prepare a master mix of the reagents below for the number of reactions required.

All enzymes should remain on ice.


Reagent

Volume (L)

Final conc.

Water

14.1




ThermoPol Buffer (10x)

4

1x

dNTPs (each 25mM)

0.4

250M each

Bst DNA Polymerase, Large Fragment (8U/L)

1.5

0.3U/L

Total

20



Add 20L of the eluted sample to 20L of the master mix (total volume/sample is 40L) and vortex.


Incubate at 370C for 20 minutes.
Purification Step:
Use MiniElute PCR Purification Kit:

Add 200L PB Buffer to samples. Transfer to column and spin for 1 minute.

Add 650L PE Buffer into the column and spin for 1 minute.

Dry spin for 1 minute.

Elute sample libraries using 33L of warm EB Buffer.

Elute control libraries using 11L of warm EB Buffer.


Index PCR:
When multiplexing libraries a unique 6 base pair index is attached to each sample to allow de-multiplexing at the analysis stage. Indexes should be unique even when the first base is removed. They should be different by at least three substitutions and should not contain three or more identical bases in a row.


Index Example

Sequence

1

GCTAGG

2

TTGATC

3

ATCTTG

4

TCTCCA

5

CATCGA

Prepare a master mix of the reagents below. Prepare 3 reactions per sample library (this reduces the number of PCR duplicates) and 1 reaction per control library.

All enzymes should remain on ice.


Reagent

Volume (L)

Final conc.

Water

29.6




Pfu Turbo Cx Buffer (10x)

5

1x

dNTPs (each 25mM)

0.4

200M each

BSA (10mg/mL)

2

0.4mg/mL

Primer: IS4 (10mM)

1

0.2M

Pfu Turbo Cx Taq. (2.5U/L)

1

0.05U/L

Total

39



Add 3L of index to each purified sample. Add 1L of index to each purified control.


Transfer 39L of master mix into reaction tubes (3 reaction tubes per sample, 1 reaction tube per control).

Add 11L of index/sample mix to each reaction tube (3 reaction tubes per sample, 1 reaction tube per control). Each reaction tube should contain a total volume of 50L.


Reaction Conditions:


Temperature 0C

Time




Volume: 50L

95

2 minutes







95

30 seconds







60

30 seconds




20 x cycles

72

1 minute 10 seconds







72

10 minutes







8

Hold






Note: Depending on the samples/research undertaken Pfu Turbo Cx Taq can be replaced with other Taq polymerase. See Dabney and Meyer (2012).


Purification Step:
Use MiniElute PCR Purification Kit:

Add 200L PB Buffer to samples (total volume/sample is 250L). Transfer to column and spin for 1 minute.

Add 650L PE Buffer into the column and spin for 1 minute.

Dry spin for 1 minute.



Elute using 22L of warm EB Buffer.
Combine the final elutes per sample, total volume per library sample is approximately 60L.
References
Adler CJ, Haak W, Donlon D, Cooper A (2001) Survival and recovery of DNA from ancient teeth and bones. Journal of Archaeological Science 38, 956-964.
Ancient DNA: Methods and Protocols, Methods in Molecular Biology (eds. Shapiro B, Hofreiter M). 2012. Springer.
Cooper A, Poinar HN (2000) Ancient DNA: do it right or not at all. Science 289, 1139.
Dabney J, Meyer M (2012) Length and GC-biases during sequencing library amplification: A comparison of various polymerase-buffer systems with ancient and modern DNA sequencing libraries. Biotechniques 52, 87-94.
Meyer M, Kircher M (2010) Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harbor Protocols 2010, pdb prot5448.


The database is protected by copyright ©ininet.org 2016
send message

    Main page