Performance Report for Cooperative Agreement No: na06oar4810163 for the Period from September 1, 2006 to August 31, 2012 University of Maryland Eastern Shore
Download 7.02 Mb.
|
Publication: Josh Newhard, M.S. Dissertation 2010?, University of Maryland Eastern Shore 11) Project Title: Impact of the Probiotic Dietary Supplement Lactobacillus acidophilus on Rainbow Trout in an Aquaculture System Project Description: This project proposes to test the hypothesis that: 1) a rainbow trout diet supplemented by Lactobacillus spp. will result in increased health of the fish as monitored by increased growth relative to fish fed a control diet, and that, 2) potential changes in gut flora are the result of changes induced by probiotics using denatured gradient gel electrophoresis (DGGE) and genomic analysis. Thematic Area Addressed: Aquaculture Lead Scientists: Dr. Joseph Pitula (UMES) and Dr. Feng Chen (UMBI-COMB) NOAA Collaborator(s): None LMRCSC Student(s): Danielle Morvan (Undergraduate student, UMES); Project is serving as a dissertation topic for Mr. Habib Bakht (an international student). LMRCSC Collaborator(s): Dr. Feng Chen (UMBI-COMB) Outside Collaborator: Dr. Moti Harel (Advanced Bio-Nutrition) LMRCSC Research Student: None Planned Start Date: November 1, 2007 Planned End Date: October 31, 2008 Planned and actual results of project: The influence of probiotic diets on growth of rainbow trout was evaluated. Pre-smolt fry were fed 3 times a day based on 1.5% of their body weight. Three groups of 100 fish were provided a standard trout diet for 1 week. One group was continued on standard diet (non-probiotic diet) for the remaining weeks (C, D3). The other two groups were fed a probiotic diet (microencapsulated with Lactobacillus acidophilus [D1] and L. acidophilus in combination with L. rhamnosus [D2]) which continued for the next 3 weeks, followed by the standard diet for the remainder of the study. Two of the probiotic diets displayed modest growth enhancement relative to control. The stronger performing diet #1 resulted in overall 7.63% increase in mass after 21 days, which declined relative to the control by about 1% for the remaining 35 days of the study. The next part of the project was to understand the microflora of the rainbow trout guts and how the three diets compared. It was hypothesized that probiotic diets would change the microflora in the gut such that more of the probiotic would be colonizing the gut, as predicted by Harel, 2003, coincident with a decrease in potentially harmful organisms. Two undergraduate interns were recruited to conduct these studies at the Center of Marine Biotechnology (COMB). First a method for extraction of bacterial DNA from rainbow trout fingerling fish guts was developed using a traditional DNA/Chloroform extraction method (T) based on Kan et al. (2005), a Qiagen Inc. DNA extraction kit (K), and a combination approach employing the traditional method to extract the DNA followed by purification on filters from the kit. The extract was subjected to PCR analysis with primers directed to a variable region within the bacterial 16S ribosomal RNA. Distinct amplification products were observed for weeks 1, 2, and 4. It is not known why amplification of DNA products was not observed for weeks 3 and 5. Nevertheless the undergraduate interns were successful in amplifying 16S rRNA gene fragments from the bacterial flora. Finally, a rapid fingerprinting method was employed, denaturing gel gradient electrophoresis (DGGE), to compare microbial communities from various gut samples. Although no specific differences were readily apparent in the DGGE analysis, a method for identification of bacterial populations within the gut microflora was established. How will results be incorporated into NOAA Fisheries operations? With the renewed interest on off-shore aquaculture within NOAA, development of alternative approaches to control diseases is essential. This work will assist greatly in understanding the effect of probiotics on resistance to common bacterial diseases and, if successful, allow for future culturists to avoid antibiotics. How will results be incorporated into LMRCSC research and curriculum? This project has helped train two undergraduate students and one graduate student in the techniques of DNA isolation, PCR, and DGGE analysis in a study aimed at understanding bacterial flora associated with 2 probiotic diets and 1 control diet. 12) Project Title: Validation of molecular probes for use in investigating environmental reservoirs of crab disease Project Description: The parasite Hematodinium sp. is associated with episodic losses of blue crab in ‘hotspots’ within these areas. The existence of hotspots implies an environmental reservoir of parasite. With participation of LMRCSC-supported interns, we developed an improved PCR-based assay for Hematodinium sp. which will allow positive identification of Hematodinium in water, sediment, and possible reservoir hosts (e.g., blue crab prey). Application of the assay to hotspots adjacent to different terrestrial inputs may provide information on how land use affects diseases of this keystone species. To better understand, predict, and possibly control Hematodinium sp.-related crab mortality, managers need information on the extent and persistence of sediment reservoirs of the parasite. An active collaboration between UMBI-COMB, UMES, NOAA-COL and DSU will examine the spatial and temporal dynamics of Hematodinium sp. in sediment reservoirs in MD and DE coastal bays with different terrestrial inputs. Parasite detection will be accomplished by a specific and sensitive Q-PCR assay (ITS2-based) developed by this consortium with LMRCSC-funding. The two objectives are: 1. Validate the ITS-based Q-PCR assay for Hematodinium sp. in the blue crab, in sediment that is spiked with defined amounts of Hematodinium and Hematodinium DNA. 2. Apply the ITS-based assay to sediment from known, active ‘hotspots’ and extend the study to environmental and biological samples taken from coastal bays with different land use inputs. Thematic Area Addressed: Essential Fish Habitat Lead Scientist: Dr. Eric J Schott (UMBI-COMB) NOAA Collaborator: Dr. John Jacobs (NCCOS, Cooperative Oxford Lab) LMRCSC Collaborators: Dr. Joseph Pitula (UMES), Dennis McIntosh (DSU) LMRCSC Research Students: Ammar Hanif (B.S., Morgan State University, Prospective MEES student, UMBI-COMB), Joanna Donaldson (Undergrad. student, UMES). Crystal Burton (Undergrad. student, UMES) Planned Start Date: Nov 1, 2007 Planned End Date: Oct 31, 2008 Actual results of project: 1. Validation of the ITS2-based assay. A) The ITS2 (internal transcribed spacer 2)-based assay for Hematodinium was developed as a result of a previous LMRCSC summer project in which it was discovered that the SSU (small subunit)-based assay was not specific enough to identify only Hematodinium in sediment DNA. Using sequence information obtained with NOAA-NMFS funding to UMBI-COMB’s Blue Crab project, and in collaboration with NOAA-COL Oxford lab (G. Messick), primers and probe were developed for real time quantitative PCR of the ITS2 region of the Hematodinium rRNA gene cluster: ITS2For: AGGTCTAATGCTTGTTGGCC ITS2Rev: CACTAGTCCGAAAACCTGTG Probe: ACCGCTACTCTTCTTCCGCCCT. A standard curve of the ITS2 assay was constructed using a cloned plasmid copy of the rRNA gene target. This showed that the sensitivity of the assay is approximately 20 gene copies, at a Ct of 39 to 40. Based on previous work using the SSU gene target (Nagle et al, in revision), there are an estimated 5,000-10,000 copies of the rRNA gene complex per parasite cell. Thus, the sensitivity of the assay is 0.004 cell. In practice, this means that if a single Hematodinium cell is present in a sample, and DNA extraction is at least 50% efficient, then a 1 µl aliquot of a 100 µl DNA preparation will produce positive results. B) A standard curve was constructed using DNA extracted from a dilution series of Hematodinium cells. This curve confirmed that the assay can easily detect Hematodinium in a DNA extract from a dilution predicted to contain only 1-2 Hematodinium cells. C) Testing the assay on DNA extracted from sediment (Baltimore Harbor) confirms that this sediment, as predicted, is negative for Hematodinium. Attempts to spike this sediment with Hematodinium DNA prior to extraction procedures resulted in negative assay results as well. While it may seem surprising that the spiking of sediment with target DNA did not result in positives by PCR, it is actually in agreement with results communicated to us by other labs (SkiO) working on Hematodinium. The addition of naked DNA to a sediment sample is likely to result in the rapid degradation of the DNA by nucleases in the sediment. 2. Application of the assay to ‘hotspot’ sediment. – Demonstration of the power of molecular tools for retrospective studies. A) Real time PCR testing of 16 sediment DNA samples identified a single sample that was reproducibly positive for Hematodinium ITS2. It derived from the Herring Creek region of Isle of Wight, whereas negative samples were from Marshall Creek and St Martin. The validity of this positive sample was confirmed by amplification with a separate set of ITS2-targeted primers that produce a ~250 bp fragment (F3: CCAACAACACT-TATGACCCACT, R3: TTGGTTTCTTT-TCCTCCGCTT) (Fig. 2A). This product was then sequenced and shown to be identical to the authentic Hematodinium ITS2 sequence in that region. Summer collections of sediment and crabs in the Ocean City area (Joe Pitula) were in conjunction with MD DNR. The priorities of DNR were in the southern area of Ocean City, quite near the inlet, and so the Marshall Creek area was not re-visited. Sediment DNA extractions and PCR analyses of OC samples were conducted at both UMES and UMBI-COMB, and both revealed no signal for Hematodinium. However, there were over a dozen crabs collected at the OC locations (June and July 2008). B) Summer sampling in both Indian River Inlet and Ocean City areas: Indian River Inlet: July 2, 2008: With the assistance of D. McIntosh (DSU) and Dewayne Fox (DSU), students Ammar Hanif and Joanna Donaldson obtained samples of sediment and water at 7 sites in the Indian River Inlet. DNA was extracted from each sample and assayed using the ITS2-based real time PCR method, which showed that all the sediment samples were positive for Hematodinium. In contrast, all the water samples were negative. To be certain that the water samples contained amplifiable DNA, “universal” dinoflagellate primers (Oldach et al, 2000) were used to amplify a conserved product from DNA extracted from water samples. All water DNA preparations produced the expected band, and did not inhibit PCR. Sampling July 28, 2008: A follow-up sampling at IR Inlet, with help from DSU’s Don Wujtewicz and two of his students, coincided with a mass mortality of crabs. In this sampling trip, water and sediment were collected, as were invertebrates and crabs. Hemolymph from two moribund crabs was examined by microscopy following the sampling, and showed over 1 million Hematodinium cells per ml of hemolymph. DNA was extracted from all samples and assayed using the ITS2 method. Results show that all sediment was positive and all water was negative. Highest Hematodinium signal was found in locations with fine-grained, or muddy sediment. Sand-rich and clay sediments in areas that had high velocity water during shifting tides showed the lowest Hematodinium signal. Blue crabs had a Hematodinium prevalence of over 60%. Two of the parasite negative crabs were noted to be healthy upon collection. All of the unhealthy crabs were either infected with Hematodinium or had evidence of reovirus infection. A single dying green crab was collected, and found to be positive for the Hematodinium ITS2 as well, indicating that infections can enter at least one sympatric crab species. A subset of Q-PCR blue crab positives were subjected to verification of Q-PCR positives by amplification with primers F3/R3. Because it is possible that other species in close contact with blue crabs may also harbor the parasite, periwinkles (Littorina) were tested, which appeared to be grazing on the surface of shells of dead crab along the shore, and found them to be negative for Hematodinium. Grass shrimp (Palaemonetes pugio), that exists in the study area were also tested and found them to be negative. Implications of the findings: The study showed that in Indian River Inlet, sediment and not water, contained Hematodinium in quantity enough to be detected by Q-PCR. The lack of signal in water, based on volume filtered and amount of DNA used, indicates that there was less than one Hematodinium cell per ml of water, even during an active outbreak of the parasite that was killing crabs on July 28, 2008. Together, this also shows that the Hematodinium signal was truly in sediment, and not in the surrounding water. The lack of signal in periwinkles and grass shrimp, even during an outbreak, suggests that the parasite is not non-specifically distributed. The presence of the parasite in two non-Callinectes portunids, the Green crab and Lady crab, suggests that there are possible reservoir hosts in the coastal bays. How will results be incorporated into NOAA Fisheries operations? The ITS2 assay is performing very well for detecting Hematodinium DNA in sediment, and is equally useful for screening potential reservoirs hosts. It is hoped that, through an on-going collaboration with UMBI-COMB (Schott) and the Cooperative Oxford Lab, (Jacobs, co-PI) technology validated in this study will be incorporated into on-going ecological assessments of Chesapeake Bay and coastal bays, as well as yearly surveys of crab health. Already Q-PCR assays are being applied to annual crab health surveys conducted by G. Messick at COL, with the expectation that it will become a standard part of Hematodinium sp. forecasting. How will results be incorporated into LMRCSC research and curriculum? Application of Q-PCR as a method to detect and quantify disease-causing organisms is becoming a standard in many contexts, and it is imperative that students, future researchers and managers, be familiar with this technique. Q-PCR provides a powerful tool in many other fisheries contexts, such as fish larve identification, as well as plankton and benthic microbial consortium and community analyses. Students who understand the fundamentals of Q-PCR will also be prepared to conduct and interpret other molecular studies. This training has broadened students’ perspective and tied together the field-based and lab-based investigations into a holistic approach to understanding disease prevalence. Publications: Nagle, L., Place, A., Jagus, R., Schott, E.J., Messick, G. and Pitula, J.S. (2009) Real-time quantitative PCR-based assay for enhanced detection of Hematodinium sp. Infection and tissue Invasion in the blue crab (Callinectes sapidus). Dis. Aquat. Org. 84, 79-87. Appendix IIc: Brief Descriptions of TAB Approved Projects (2008/2009) TAB Approved Projects for 2008/09 Presented below are descriptions of research work done for projects approved by the TAB for 2008/2009. 1) Project title: Effects of temperature change on the distribution and behavior in Lophius americanus Project Description: Shifts in distribution of marine species have been predicted as a result of climate change (Briggs, 1974; Rose 2005) and a number of marine species have shown shifts consistent with response to increasing temperatures (Murawski, 1993; Perry et al., 2005; Rose, 2005). For example, North Sea waters have warmed 1.05C (between 1977 and 2001) and mean latitude of occurrence of 21 species of exploited and unexploited fish (out of 36) have changed significantly over this 25 year period (Perry et al., 2005). This included a significant northward shift in mean latitude for monkfish Lophius piscatorius (Perry et al., 2005). In the northwest Atlantic, Murawski (1993) examined latitudinal range of 36 Atlantic fish species during 1967-1990 and found a significant northward trend in 12 species that was associated with variation in water temperature (Murawski, 1993). Temperature anomalies calculated from NEFSC survey hydrographic data (Mountain et al. 2004) show a trend of increasing frequency of positive (warmer) anomalies in the years since Murawski’s study, suggesting that further examination of shifts in distribution is warranted. Monkfish is the highest valued finfish in the Northwest Atlantic, yet aspects of its biology remain poorly understood. Monkfish fishermen in the US assert that temperature plays a key role in the distribution of monkfish and in the timing of onshore migration in the spring. If temperature is an important controlling factor in monkfish behavior, shifts in distribution of monkfish may have occurred in recent years. Since little is known of temperature-related behavior of American monkfish, Lophius americanus, it was proposed to determine the influence of temperature on the distribution of monkfish in the northwest Atlantic and examine the role of temperature in triggering migration in spring (onshore) and fall (offshore). In addition, the study was aimed at determining the reproductive stage of migrating monkfish to address questions related to location and timing of spawning. Thematic area addressed: Essential Fish Habitat Lead Scientist: Dr. Andrea Johnson (UMES) NOAA Collaborator: Drs. Anne Richards and Jim Manning, (Northeast Fisheries Science Center, Woods Hole, MA) LMRCSC Collaborator(s): none LMRCSC Research Student: Daniel Cullen, (M.S. student, UMES) Industry collaborators: John Stolgitis (Point Judith, RI), Chris Hickman (Chincoteague, VA), Peter Krasowski (Point Pleasant, NJ), Brian Roche (New Bedford, MA), Stephen Lee (Portsmouth, NH), Charlie Dodge (Chatham, MA) and Roger Wooleyhan (Ocean City, MD). Planned Start Date: January 2009 Planned End Date: December 2009 Actual Start Date: January 2009 Actual End Date: December 2009 Planned and actual results of project: Trawl Survey Data –Data from NEFSC annual bottom trawl surveys for spring (1968 to 2008), and autumn (1963 to 2008) were acquired for analysis. Surveys conducted by NEFSC use a stratified random sampling design with strata defined by latitude and bathymetry. Survey locations include a series of 350 stations that range from the Gulf of Maine south to Cape Hatteras, North Carolina (Fig. 1). Sampling at each station includes weighing and enumerating each species as well as recording data on length, age, maturity, and diet composition. Further, information on sea surface temperatures, bottom temperatures, and bottom depths is also recorded. NEFSC data for spring and autumn groundfish surveys were partitioned into five distinct geographic shelf regions defined by survey strata (Fig. 1a). Both inshore and offshore strata were combined along with information regarding physical and ecosystem properties (Townsend et al., 2006; Fogarty et al., 2008) when delineating the regions. The five regions include the Southern Mid-Atlantic Bight (S-MAB; Strata 61 – 76), Northern Mid-Atlantic Bight (N-MAB; Strata 1 – 12), Georges Bank (GB; Strata 13 – 23, 25), Eastern Gulf of Maine (E-GOM; Strata 24, 26 – 30,36 – 40), and Western Gulf of Maine (W-GOM; Strata 31 – 35; Fig. 1). For each region, cumulative distribution functions were calculated to describe the association between monkfish distribution and bottom temperature and depth. For example, 90% of monkfish caught during NEFSC surveys for both spring and autumn in the S-MAB were associated with temperatures of 2.0 – 12.5˚C while 90% of all stations sampled included temperatures ranging from 1.5 – 25.2˚C. Compared to the bottom temperature distribution of the stations, monkfish occupied cooler temperatures in autumn and warmer temperatures in spring. Similarly, 90% of the depth distributions for monkfish caught in the S-MAB for spring and autumn ranged from 9 – 345 m while 90% of sampled depths at stations varied from 9 – 121 m. For both seasons, monkfish were generally associated with greater depths when compared to the depth distribution of the stations. In the S-MAB, monkfish distributions appear to shift toward deeper areas and warmer temperatures in spring and cooler temperatures in autumn. Compared to the S-MAB, cumulative distributions for sampled bottom temperatures and depths for the western Gulf of Maine reflected occupied distributions for monkfish. For example, 90% of monkfish caught during NEFSC surveys for all seasons in the W-GOM were associated with temperatures of 2.0 – 10.1˚C while 90% of all stations sampled included temperatures ranging from 2 – 9.8˚C. Compared to the bottom temperature distribution of the stations, monkfish occupied warmer temperatures in both spring and autumn. Similarly, 90% of the depth distributions for monkfish caught in the W-GOM for all seasons ranged from 9 – 295 m while 90% of sampled depths at stations varied from 9 – 265 m. For both seasons, monkfish were generally associated with greater depths when compared to the depth distribution of the stations. Circumstances in the W-GOM, were less variable than in the S-MAB and mirrored preferred hydrographic conditions for monkfish. Thus, selection for thermal habitat is more important in the S-MAB where temperatures are highly variable by season. Based on the range of (90%) occupied temperatures in the S-MAB, preferred temperatures for monkfish ranged from 2.2 to 12.8˚C and 5.2 to 14.4˚C for spring and autumn, respectively. The amount of area (squared nautical miles; Sq nm) within the range of preferred temperatures during spring in the S-MAB declined from 12000 to 10000 Sq nm from 1968 to 2002 while the amount of area above the range of preferred temperatures increased from 500 to 2700 Sq nm2. During the autumn season, the amount of area within the range of 5.2 to 14.4˚C increased from 6300 to 9500 Sq nm from 1975 to 1981 and declined to 7000 Sq nm in 2001. The amount of area that exceeded the preferred range of monkfish temperatures in autumn doubled that of the area that was greater than the distribution of preferred temperatures during spring. In the W-GOM, preferred temperatures for monkfish ranged from 2.0 – 8.0˚C and 4.2 – 10.1˚C in the spring and autumn, respectively. The amount of area within the range of preferred temperatures during spring in the W-GOM declined from 18500 to 17900 Sq nm from 1968 to 2008 while the amount of area above the range of preferred temperatures increased from 1900 to 2400 Sq nm. During autumn, the area within the range of 4.2 to 10.1˚C, decreased from 20000 to 18600 Sq nm while the area above increased from 135 to 1800 Sq nm from 1968 to 2008. Though there was a general decrease in the area within the preferred temperature range for the W-GOM, the decline in optimal temperatures for monkfish was greater for autumn in the S-MAB. Monkfish in the S-MAB may experience thermal habitat loss during autumn in response to increasing bottom temperatures. The influence of water temperature on monkfish distribution will also be investigated by examining relationships among environmental variables using general linear models. Methods include regressing mean weighted latitude and bottom depth against same-year and 5-year running average bottom temperatures and abundance indices for all shelf regions combined for spring and autumn bottom trawl surveys.
The probes were attached to one end of each gillnet along the bottom or lead line. In the southern most areas including Pt. Pleasant, NJ temperature and catch data were collected for the months of November to February. Data collection in more northern areas such as Pt. Judith, RI began October and continued until February. The bottom temperature time series plots for both areas presented here show a general cooling trend over time with the warmest temperatures occurring during the autumn months. Patterns in monkfish catch (# of fish/day) showed fluctuations over time with little relation to changes in bottom temperature, suggesting that other factors in addition to temperature may be affecting catch rates. Further, graphical representation of new and full lunar phases with temperature and catch time series does not indicate discernable relationships among the variables. Other methods to elucidate the influence of temperature on monkfish catch include identifying specific relationships (linear, non-linear) between temperature and catch and examining thermal fronts. Additionally, lunar cycle influences on monkfish catch may be examined for patterns using a technique called periodic regression which detects cyclical patterns in data over a known time period (deBruyn and Meeuwig, 2001). In general, total length measurements taken for monkfish sampled from all locations ranged from ≈ 50 to 96 cm with averages of 76 cm. However, during some sampling trips, monkfish size may show varying patterns such as those caught during February off the coast of Pt. Judith, RI. Here the minimum and maximum sizes of monkfish caught ranged from 26 to 36 cm with a mean of 30.7 cm. Additional information including GPS location, catch weight, water current direction, and gonad samples for assessing reproductive condition were also collected. Tissue samples taken from a sample size of 25 fish per net haul have yet to be processed for histopathology. 
Fig. 1. Survey stratification scheme for NEFSC trawl surveys includes five distinct geographic region (a) and 350 stations (b). The entire area is sampled during surveys. 2. Project Title: Essential Fatty Acid Composition and Immune Response of Chesapeake Bay Striped Bass Project Description: Efforts are underway to determine if: 1) fluctuations in the fatty acid composition of Chesapeake Bay striped bass Morone saxatilis can be related to their health condition through monitoring of their immune status and, 2) how changes in the amount of dietary polyunsaturated fatty acids (PUFA) affect the immune response and progression of mycobacteriosis in these fish. With these goals in mind, striped bass are currently being collected during the summer and fall from the Chesapeake Bay and Delaware River. Subsequent analysis will determine if there are any temporal or spatial changes in the fatty acid profiles of these fish. A feed study was completed at the NOAA Cooperative Oxford Laboratory in order to satisfy goal #2. Additional work will be performed in project year 2008-09 to further elucidate the role of polyunsaturated fatty acids in the immune response of striped bass. Thematic Area Addressed: Essential Fish Habitat Lead Scientists: Lonnie Gonsalves (Ph.D. Student, UMES), Dr. E.B. May (UMES), Dr. R. Jagus (UMBI-COMB) NOAA Collaborators: Dr. Ashok Deshpande (NOAA/NMFS/NEFSC), Dr. John Jacobs (NOAA/NOS/Cooperative Oxford Laboratory) LMRCSC Collaborator: Dr. Rosemary Jagus (UMBI-COMB) LMRCSC Research Student: Lonnie Gonsalves (Ph.D. Student, UMES) Other Collaborator: Dr. Kyle Hartman (University of West Virginia) Planned Start Date: December 2008 Planned End Date: December 2009 Actual Start Date: December 2008 Actual End Date: May 2010 Planned and actual results of project: The objectives for Year 2 of this study were to: 1) complete analysis of samples from the year 1 feed study, 2) collect wild striped bass during the summer and fall from the Choptank River and the Delaware River watershed, and 3) analyze young-of-year striped bass from the Choptank River using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) at UMBI-COMB, to detect the presence of Mycobacterium spp. Samples from Year 1 feed study were collected in order to test phagocytosis, leukotriene production, disease progression via histological examination , fatty acid composition of fillets, and bacterial loads in spleens. Each component of the feed study has been completed except for analysis of cell supernatants for leukotriene production and analysis of fatty acids. Cell supernatants from 1 of 4 of the sampling time periods have been analyzed via enzyme immunoassay. Analysis of the remaining supernatants is currently being conducted. Fatty acid analysis of fillets will be conducted concurrently with analysis of fillets from wild striped bass at the NOAA Howard Marine Laboratory during winter 2009-2010. Results from the year 1 feed study demonstrated that neither the diet nor injection with M. marinum had a significant effect on in vitro phagocytosis of yeast (Fig. 2). Analysis of cell supernatants from fish sacrificed at 4 weeks post-infection also show that neither diet nor injection had a significant affect on production of leukotriene B4 by stimulated leukocytes (Fig. 3). We observed a relatively low number of granulomas in tissues from fish injected with mycobacteria. Of those fish with granulomas, many of these lesions were present only in the visceral lining without bacterial penetration into the adjacent tissues. Bacterial counts derived from culturing homogenized spleens also demonstrated that low quantities of bacteria were present in the spleens from fish fed either diet. This evidence suggests that the strain of bacteria used in this study was not effective in inducing disease. Forty-nine striped bass have been collected from the Choptank River and six from the Delaware River watershed via hook-and-line between July-August. Spleens from each fish were partitioned into multiple pieces and preserved in either 10% formalin for histological examination or 95% ethanol for mycobacteria detection and quantization of total bacterial load via PCR-RFLP. Additional portions were frozen immediately for analysis of leukotrienes. Either the fillet or the whole fish was frozen immediately for subsequent fatty acid analysis. An additional 30-50 fish will be collected from both areas during fall 2009. Preparation of histology sections and observation of slides will take place fall 2009-spring 2010. Mycobacteria detection and the quantization of total bacterial loads will also be conducted over this time period. Fatty acid analysis of summer and fall samples will be conducted during the winter and spring of 2010. Support for an undergraduate research student at the UMBI-COMB was provided during summer 2009. The focus of the ten-week internship was to develop protocols for use of PCR-RFLP to detect total bacteria and differentiate presence/absence of M. marinum clade species. Eighteen (18) young of the year (YoY) striped bass, 10 white perch (Morone americana), 2 Atlantic croaker (Micropogonias undulatus), 1 killifish (Heterandria formosa) and 1 bay anchovy (Anchoa mitchilli) were collected from the Choptank River in June-July. Spleens were analyzed using PCR-RLFP in all fish except for the killifish and bay anchovy; the whole body was homogenized before analysis for these two species. The use of these molecular assays indicated the presence of Mycobacterium spp. within one YoY striped bass and one white perch. Mycobacteriosis was not detected in the remaining 17 YoY striped bass and other adult striped bass prey items. How will results be incorporated into NOAA Fisheries operations? These results will better define the importance of essential fatty acid-rich prey (e.g. Atlantic menhaden, Brevoortia tyrannus) in the diet of striped bass. The findings may provide a link between the diet of striped bass and the increase in natural mortality/disease outbreaks seen in striped bass since the mid 1990’s. These results will also test the use of essential fatty acids as bioindicators of species fitness in wild fish. This project is relevant to NOAA NMFS Research Priority Group 1: Research to support fishery conservation and management, and subgroup 2: Interdependence of fisheries or stocks of fish. How will results be incorporated into LMRCSC research and curriculum? The current results will be used to validate markers of immune function prior to their application in wild fish. The project provides a mechanism for the LMRCSC to play a pivotal role in the elucidation of the current threats to Chesapeake Bay striped bass, one of the leading fisheries in the Mid-Atlantic region of the U.S. The data from this study will be used to fulfill part of the requirements for the doctoral degree program of Lonnie Gonsalves. Additionally, training and mentorship for an undergraduate student was provided. Fig. 2: Striped bass leukocytes were isolated from fish fed either a high (H) or low (L) PUFA diet and injected with M. marinum (+) or phosphate buffer solution (-). Following incubation with FITC-labeled yeast, absorbance was read at 490 nm and compared to standard curves. Values are reported as average number of yeast engulfed/ leukocyte. Both diet and injection of M. marinum did not have a significant effect on phagocytosis. Phagocytosis was highest at weeks 2 and 4 and lowest at week 8. Leukocytes isolated at week 0 and M. marinum injected fish from week 2 failed to undergo phagocytosis due to prior degradation of the sample. Fig. 2: Phagocytosis of FITC-Yeast 
Directory: cms300uploadedFiles cms300uploadedFiles -> Kiah 1127 phone: 410-651-6429 office hours: mw 9: 00-10: 00 am, tu th 12: 00-3: 00PM cms300uploadedFiles -> Performance Report for Cooperative Agreement No: na11sec4810002 for the Period from July 1 to December 31, 2011 University of Maryland Eastern Shore Living Marine Resources Cooperative Science Center Paulinus Chigbu, Ph Download 7.02 Mb. Share with your friends:
|