Epa teacher Sequences: Fish 1 FishyFish



Download 183.61 Kb.
Page2/2
Date23.04.2018
Size183.61 Kb.
1   2

Fish_1_FishyFish

Bluefin Tuna Thunnus thynnus

COX1

NC_004901 REGION: 5475..7025



>gi|34577043:5475-7025 Thunnus thynnus thynnus mitochondrion, complete genome GTGGCAATCACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTCTATCTAGTATTCGGTG CATGAGCTGGAATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCT TCTTGGGGACGACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTA ATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATGATCGGAGCCCCCGACATGGCAT TCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCTTCTTTCCTTCTGCTCCTAGCTTCTTCAGG AGTTGAGGCTGGAGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTAGCCCACGCAGGG GCATCAGTTGACCTAACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACT TCATCACAACAATTATCAATATGAAACCTGCAGCTATTTCTCAGTATCAAACACCACTGTTTGTATGAGC TGTACTAATTACAGCTGTTCTTCTCCTACTTTCCCTTCCAGTCCTTGCCGCTGGTATTACAATGCTCCTT ACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACC TATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCTGGGTTCGGAATGATCTCCCACAT TGTTGCCTACTACTCAGGTAAAAAAGAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATC GGCCTACTAGGGTTCATCGTATGAGCCCACCACATGTTCACGGTAGGAATGGACGTAGACACACGGGCAT ACTTTACATCCGCAACTATAATTATCGCAATTCCAACTGGTGTAAAAGTATTTAGCTGACTTGCAACCCT TCACGGAGGAGCTGTTAAGTGAGAAACCCCTCTGCTATGAGCCATTGGCTTTATTTTCCTCTTTACAGTT GGAGGGCTAACAGGTATTGTCCTGGCCAATTCATCTCTAGACATCGTTCTACACGACACCTACTACGTAG TAGCCCACTTCCACTACGTACTATCTATGGGAGCTGTATTCGCCATTGTTGCCGCCTTCGTACACTGATT CCCACTATTCACAGGATACACCCTTCACAGCACATGAACTAAAATCCACTTCGGAGTAATGTTTGTAGGT GTCAACCTTACATTCTTCCCACAGCACTTCCTAGGACTAGCAGGAATGCCTCGACGGTATTCAGACTACC CAGACGCCTACACCCTTTGAAACACAATTTCCTCTATTGGATCCCTTATCTCCCTAGTAGCAGTAATTAT GTTCCTATTTATTATTTGAGAAGCTTTCGCTGCCAAACGTGAAGTAATGTCAGTAGAACTAACTTCAACT AACATTGAATGACTACACGGCTGCCCTCCGCCATACCACACATTCGAAGAGCCTGCATTCGTTCTAGTCC AATCAGACTAA
Fish_2_FishesRUs

Yellowfin Tuna Thunnus albacares

COX1

NC_014061 REGION: 5476..7026



>gi|295065692:5476-7026 Thunnus albacares mitochondrion, complete genome GTGGCAATCACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTTTATCTAGTATTCGGTG CATGAGCTGGAATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCT TCTTGGGGACGACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTA ATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATGATCGGAGCCCCCGACATGGCAT TCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCCTCTTTCCTTCTGCTCCTAGCTTCTTCAGG AGTTGAGGCTGGAGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTGGCCCACGCAGGG GCATCAGTTGACCTAACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACT TCATCACAACAATTATCAATATGAAACCTGCAGCTATTTCTCAGTATCAAACACCACTGTTTGTATGAGC TGTACTAATTACAGCTGTTCTTCTCCTACTTTCCCTTCCAGTCCTTGCCGCTGGTATTACAATGCTCCTT ACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACC TATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCCGGATTCGGAATGATCTCCCACAT TGTTGCCTACTACTCAGGTAAAAAAGAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATC GGCCTACTAGGGTTCATCGTATGAGCCCATCACATGTTCACAGTAGGAATGGACGTAGACACACGGGCAT ACTTTACATCCGCAACTATGATTATCGCAATTCCAACTGGTGTAAAAGTATTTAGCTGACTTGCAACCCT TCACGGAGGAGCTGTTAAGTGAGAAACCCCTCTGCTATGAGCCATTGGCTTTATTTTCCTCTTTACAGTT GGAGGGCTAACAGGTATTGTCCTAGCCAATTCATCTCTAGACATCGTTCTACACGACACCTACTACGTAG TAGCCCACTTCCACTACGTACTATCTATGGGAGCTGTATTCGCCATTGTTGCCGCCTTCGTACACTGATT CCCACTATTTACAGGATACACCCTTCACAGCACATGAACTAAAATCCACTTCGGAGTAATGTTCGTAGGT GTCAATCTTACATTCTTCCCACAGCACTTCCTAGGACTAGCAGGAATGCCTCGACGGTATTCAGACTACC CAGACGCCTACACCCTTTGAAACACAATTTCCTCTATTGGATCCCTTATCTCCCTAGTAGCAGTAATTAT GTTCCTATTTATTATTTGAGAAGCTTTCGCTGCCAAACGTGAAGTAATGTCAGTAGAACTAACTTCAACT AACGTTGAATGACTACACGGCTGCCCTCCGCCATACCACACATTCGAAGAGCCTGCATTCGTTCTAGTCC AATCAGACTAA
Fish_3_FishyFish

Spotback Skate (Atlantoraja castelnaui)

COX1

NC_025942.1 REGION: 5473-7029

>gi|733386772:5473-7029 Atlantoraja castelnaui voucher INIDEP-T 0406 mitochondrion, complete genome

GTGACAATTAATCGTTGATTATTTTCTACTAATCACAAAGACATCGGTACCCTTTATTTAATTTTTGGTG

CCTGAGCAGGTATAGTCGGGACTGGTCTCAGTCTATTAATCCGAGCTGAATTAAGCCAACCAGGAACCCT

TTTAGGTGATGACCAGATTTATAATGTTATTGTTACAGCCCATGCCTTTGTAATAATCTTTTTTATGGTA

ATACCTATCATAATCGGAGGATTCGGTAATTGACTTATCCCTTTAATGATTGGCTCACCAGATATAGCTT

TTCCACGAATAAATAATATAAGCTTCTGACTTCTTCCTCCATCTTTTCTTCTCCTACTAGCCTCAGCAGG

AGTTGAAGCCGGGGCAGGAACAGGATGAACTGTTTACCCACCTCTAGCAGGAAACCTTGCCCACGCTGGC

GCTTCTGTTGACTTAACAATTTTTTCTTTACACCTAGCAGGTATCTCCTCTATTTTAGCCTCGATTAATT

TTATTACCACAATTATTAATATGAAACCCCCAGCAATTTCACAATACCAAACACCTTTATTTGTGTGATC

TGTACTTGTTACAACTGTTCTGCTCCTTTTAGCCCTACCAGTCTTAGCAGCAGCCATCACTATACTTCTA

ACCGACCGTAACCTTAATACAACTTTCTTTGATCCTGCAGGAGGGGGAGATCCTATTTTATATCAACATC

TGTTCTGATTCTTTGGCCATCCTGAAGTCTATATTTTAATTTTACCAGGATTCGGAATAATCTCACATGT

AGTTGCTTACTATTCAGGTAAAAAAGAACCATTTGGTTATATAGGAATAGTTTGAGCAATAATAGCTATC

GGCCTTCTAGGATTTATCGTTTGAGCACACCACATATTCACAGTAGGAATGGATGTAGACACCCGAGCAT

ACTTTACATCAGCCACAATAATTATCGCTATTCCAACAGGTGTAAAAGTCTTTAGTTGATTAGCTACCCT

GCATGGAGGATCAATCAAATGAGAAACCCCATTACTATGGGCTCTAGGTTTCATTTTTTTATTTACAGTA

GGCGGTCTTACAGGAGTTGTTCTAGCAAACTCATCACTCGATATTGTTCTTCACGATACATATTATGTAG

TAGCCCACTTCCACTATGTTTTATCAATAGGAGCAGTATTCGCTATCATGGCAGGTTTTGTCCATTGATT

TCCACTATTTACAGGATACACACTCCACTCCACATGAACAAAAATTCAATTTTTAATTATATTTATCGGA

GTAAATTTAACATTTTTCCCACAACACTTCCTAGGACTAGCAGGAATACCACGACGTTACTCAGATTACC

CAGACGCATATACTCTATGAAATGTAGTATCTTCTATTGGTTCCATAATCTCATTAGTAGCTGTTATTAT

TTTATTATTTATTATTTGAGAAGCATTTGCCTCAAAACGTGAAGTACTATCAATTGAATTATCTAACACA

AACGTAGAATGACTTCACGGCTGCCCTCCTCCTTATCACACTTATGAAGAGCCAGCTTTTGTCCAAGTTC

AACAATCAACTTATTAA
Fish_4_FishesRUs

Pacific Red Snapper Lutjanus peru

COX1

NC_027950 REGION: 5488..7038



>gi|937408205:5488-7038 Lutjanus peru mitochondrion, complete genome GTGGCAATCACACGTTGATTTTTCTCGACCAATCATAAAGACATCGGCACCCTTTATCTAGTATTTGGTG CCTGGGCCGGAATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAGCTAAGCCAGCCAGGAGCTCT TCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTA ATACCAATCATGATCGGAGGATTCGGGAACTGACTGATCCCATTAATAATTGGAGCCCCTGATATGGCAT TCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCCCCATCATTCCTGTTACTGCTCGCCTCTTCTGG AGTAGAAGCCGGTGCTGGAACTGGGTGAACAGTCTACCCGCCCCTAGCAGGCAACCTGGCACACGCAGGA GCATCTGTAGACCTAACTATTTTCTCCCTACATCTGGCAGGTGTCTCCTCAATTCTAGGGGCCATTAATT TCATTACAACAATCATTAACATGAAACCCCCTGCCATCTCCCAATATCAAACACCCCTATTCGTCTGGGC CGTCCTAATTACTGCTGTCCTACTCCTTCTCTCTCTACCAGTTCTGGCAGCCGGAATTACAATACTTCTC ACAGACCGAAATTTAAACACAACCTTCTTTGACCCGGCAGGAGGAGGGGACCCCATCCTTTATCAACATC TGTTCTGATTCTTCGGGCACCCAGAAGTCTATATTTTAATTCTCCCTGGATTTGGAATGATTTCCCACAT TGTTGCCTACTACTCTGGCAAAAAAGAACCCTTCGGTTATATGGGCATGGTGTGAGCCATGATGGCGATT GGCCTTCTAGGGTTTATCGTGTGAGCCCATCACATGTTTACAGTAGGCATGGACGTAGACACTCGTGCCT ACTTCACATCCGCCACAATAATCATTGCCATTCCTACCGGGGTAAAAGTCTTTAGCTGACTAGCAACCCT TCACGGAGGCTCAATTAAATGAGAAACCCCTATACTATGAGCCCTTGGCTTCATCTTCCTCTTCACAGTG GGAGGTCTAACAGGAATCGTCCTAGCCAACTCATCACTAGACATTGTTCTACATGACACATACTATGTAG TAGCCCACTTCCACTATGTCCTGTCAATAGGAGCCGTGTTTGCCATTGTTGCCGCTTTCGTTCACTGATT CCCCCTATTCTCAGGCTACACGCTCCACAGCACTTGAACAAAAATCCACTTTGGAGTAATGTTCGTAGGG GTCAATTTAACATTCTTCCCACAACACTTCCTAGGTCTGGCTGGAATGCCTCGACGGTACTCAGACTACC CGGATGCCTATACTCTTTGAAACACAATCTCCTCTATCGGCTCCCTAATCTCCCTCGTAGCCGTAATTAT GTTCCTGTTTATCATTTGAGAAGCATTTGCCGCCAAACGTGAAGTTATGGCAGTTGAACTGACAACAACT AACGTTGAATGACTGCACGGCTGCCCTCCCCCTTACCACACATTTGAGGAGCCTGCATTCGTCCAAGTTC AATCAAACTAA


Developer: Stacey Scroggs, New Mexico State University

STC NM Contact: Michèle Shuster (mshuster@nmsu.edu)





Download 183.61 Kb.

Share with your friends:
1   2




The database is protected by copyright ©ininet.org 2020
send message

    Main page