Table strains, plasmids, and primers



Download 121.65 Kb.
Date05.08.2017
Size121.65 Kb.
#26110

TABLE S1. Strains, plasmids, and primers.













Strain

Description

Reference/Source

4220

Methicillin Sensitive Restriction Deficient S. aureus

W. Shafer

Newman

Methicillin Susceptible Clincal S. aureus Isolate

W. Shafer

COL

Methicillin Resistant Clinical S. aureus Isolate

W. Shafer

SF8300

Methicillin Resistant Clinical S. aureus Isolate

(1)

LAC

Methicillin Resistant Clinical S. aureus Isolate

NARSA

ATCC 29970

S. haemolyticus human skin isolate

ATCC

ATCC 15305

S. saprophyticus urine isolate

ATCC

AR0355

S. aureus Newman menD::ErR (NWMN_0913)

(2)

AR0407

S. aureus COL ∆ccpA::SpR (SACOL1786)

(3)

AR0455

S. aureus COL ldh1::ErR/ldh2::KnR/∆ddh::SpR (SACOL0222, SACOL2618, SACOL2535)

(4)

AR0744

S. aureus COL ∆pfkA (SACOL1746)

(5)

AR0763

S. aureus COL ∆pyc::ErR (SACOL1123)

This study

AR0766

S. aureus COL ∆pckA::KnR (SACOL1838)

This study

AR1179

S. aureus Newman ∆pckA::KnR (NWMN_1681)

This Study

AR0769

S. aureus COL ∆pyk::ErR (SACOL1745)

This study

AR1180

S. aureus Newman ∆pyk::ErR (NWMN_1592)

This Study

AR0891

S. aureus LAC ∆pyk::ErR

(6)

AR0772

S. aureus COL ∆gapB::KnR (SACOL1735)

This study

AR0777

S. aureus COL ∆gapA (SACOL0838)

This study

AR0905

S. aureus COL ∆ackA::KnR (SACOL1760)

Spahich (Unpublished)

AR1148

S. aureus COL ∆pfkA + pNV061

This study

AR1149

S. aureus COL ∆pyk + pNV041

This study

AR1150

S. aureus COL ∆pckA + pNV056

This study

AR1151

S. aureus COL ∆gapB + pNV058

This study

Plasmid

Description

Reference/Source

pBT2ts

E. coli/S. aureus shuttle vector

(7)

pBTE

1.2kb ermB (ErythromycinR) allele cloned into SmaI of pBT2ts

(4)

pBTK

1.4kb aph-A3 (KanamycinR) allele cloned ino SmaI of pBT2ts

(4)

pBTS

1.3kb aad9 (SpectinomycinR) allele cloned into SmaI of pBT2ts

(4)

pNV014

5' and 3' homology regions of pyc cloned into pBTE to yield ∆pyc::ErR

This study

pNV018

5' and 3' homology regions of pckA cloned into pBTK to yield ∆pckA::KnR

This study

pNV026

5' and 3' homology regions of pyk cloned into pBTE to yield ∆pyk::ErR

This study

pNV030

5' and 3' homology regions of gapB cloned into pBTK to yield ∆gapB::KnR

This study

pNV032

5' and 3' homology regions of gapA were amplified via overlap extension PCR and cloned into EcoRI of pBT2ts

This study

pNV034

5' and 3' homology regions of pfkA were amplified via overlap extension PCR and cloned into EcoRI of pBT2ts

This study

pTR61

ldh1::ErR in pBT2ts (ErR in internal NdeI site in ldh1)

(8)

pTR75

ldh2::KnR in pBT2ts (KnR in an engineered SalI site)

(8)

pJF103

5' and 3' homology regions of ccpA cloned into pBTS to yield ∆ccpA::SpR

(3)

pNAS24

5' and 3' homology regions of ackA cloned into pBTK to yield ∆ackA::KnR

Spahich (Unpublished)

pNV061

pfkA cloned into the NdeI/BamHI sites of pOS1-plgt

This study

pNV041

pyk cloned into theBamHI site of pOS1-plgt

This study

pNV056

pckA + 418bp upstream of the start site cloned into the BamHI site of pOS1

This study

pNV058

gapB + 201bp upstream of the start site cloned into the BamHI site of pOS1

This study

Primer

Sequence

Use

pckA-5.1A

tggtagaattcCAAGTGTCACATCCTCAGC

Deletion

pckA-5.1B

tggtagaattcTGTTTCAGTGTATGTGTCTAC

Deletion

pckA-3.1A

gtaggatccGCTGAAAAAGGTAGCTTCAAC

Deletion

pckA-3.1B

gtaggatccTAGTATGAAACGTGGTGTGC

Deletion

pfkA-5.1A

tggtagaattcTGCAAGAAAGACCTACGACC

Deletion

pfkA-5.1B

TCCACCACTAGTTAAAACTGCCAAGGTGAAACAGCTAAGGG

Deletion

pfkA-3.1A

CCCTTAGCTGTTTCACCTTGGCAGTTTTAACTAGTGGTGGA

Deletion

pfkA-3.1B

tggtagaattcCCAGCAGCAGTTTCACCAG

Deletion

pyk-5.1A

tggtagaattcGCAGTTTTAACTAGTGGTGG

Deletion

pyk-5.1B

tggtagaattcGCTGGTCCAATTGTACATAC

Deletion

pyk-3.1A

gtaggatccACGATTGATGCTGCTCAAGG

Deletion

pyk-3.1B

gtaggatccAGAAGGTGTTTGATCTTGAGC

Deletion

gapB-5.1A

tggtagaattcGATTATCGTCATGCTGATGG

Deletion

gapB-5.1B

tggtagaattcCTTCCAATTCTACCCATACC

Deletion

gapB-3.1A

gtaggatccCTGAGCAAATTGGAGCAC

Deletion

gapB-3.1B

gtaggatccCGCCTTTAACAATCCAATCG

Deletion

pckA-5.1A

tggtagaattcCAAGTGTCACATCCTCAGC

Deletion

pckA-5.1B

tggtagaattcTGTTTCAGTGTATGTGTCTAC

Deletion

pckA-3.1A

gtaggatccGCTGAAAAAGGTAGCTTCAAC

Deletion

pckA-3.1B

gtaggatccTAGTATGAAACGTGGTGTGC

Deletion

gapA-5.1A

tggtagaattcCGAACATATGGATATGACTGAACG

Deletion

gapA-5.1B

GCTAAGTATGCTAATGTACGAACTGCTAAACGACCAATTCTACC

Deletion

gapA-3.1A

GGTAGAATTGGTCGTTTAGCAGTTCGTACATTAGCATACTTAGC

Deletion

gapA-3.1B

tggtagaattcATGGTACTACAGTGATTTTGGC

Deletion

pyc-5.1A

ggtagaattcGTAACGGTGGCGTATTTGG

Deletion

pyc-5.1B

tggtagaattcGCAATTTCTCCACGGTTAGC

Deletion

pyc-3.1A

gtaggatccGTGACACAATAGCGACAGG

Deletion

pyc-3.1B

gtaggatccGTTACCAAAACCGGATCAGC

Deletion

pfkA-lgt

tggcacatatgAAGAAAATTGCAGTTTTAACTAGTGG

Complementation

pfkA.1B

tggtaggagtccGCTGGTCCAATTGTACATAC

Complementation

pyk.2A

tggtaggatccCAAGGTGAAACAGCTAAGGG

Complementation

pyk.1B

tggtaggatccCCTTTCCATTGTTGATAAATGG

Complementation

gapB.1A

tggtaggatccTTGAAAAGCCGAATTACGGAG

Complementation

gapB.1B

tggtaggatccTCCGAAGTCAGAGTTAGGC

Complementation

pckA.1A

tggtaggatccTCCTTCTGTAACAGACTCTG

Complementation

pckA.1B

tggtaggatccCCCGTTCACACGGGTGG

Complementation

1. Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davidson MG, Lin F, Lin J, Carleton HA, Mongodin EF, Sensabaugh GF, Perdreau-Remington F. 2006. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. The Lancet 367:731–739.

2. Joshi GS, Spontak JS, Klapper DG, Richardson AR. 2011. Arginine catabolic mobile element encoded speG abrogates the unique hypersensitivity of Staphylococcus aureus to exogenous polyamines. Mol Microbiol 82:9–20.

3. Crooke AK, Fuller JR, Obrist MW, Tomkovich SE, Vitko NP, Richardson AR. 2013. CcpA-Independent Glucose Regulation of Lactate Dehydrogenase 1 in Staphylococcus aureus. PLoS ONE 8:e54293.

4. Fuller JR, Vitko NP, Perkowski EF, Scott E, Khatri D, Spontak JS, Thurlow LR, Richardson AR. 2011. Identification of a Lactate-Quinone Oxidoreductase in Staphylococcus aureus that is Essential for Virulence. Front. Cell. Inf. Microbio. 1:1–15.

5. Mike LA, Dutter BF, Stauff DL, Moore JL, Vitko NP, Aranmolate O, Kehl-Fie TE, Sullivan S, Reid PR, DuBois JL, Richardson AR, Caprioli RM, Sulikowski GA, Skaar EP. 2013. Activation of heme biosynthesis by a small molecule that is toxic to fermenting Staphylococcus aureus. Proceedings of the National Academy of Sciences 110:8206–8211.

6. Kumar NS, Dullaghan EM, Finlay BB, Gong H, Reiner NE, Selvam JJP, Thorson LM, Campbell S, Vitko N, Richardson AR, Zoraghi R, Young RN. 2014. Discovery and optimization of a new class of pyruvate kinase inhibitors as potential therapeutics for the treatment of methicillin-resistant Staphylococcus aureus infections. Bioorganic & Medicinal Chemistry 22:1708–1725.



7. Brückner R. 1997. Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol. Lett. 151:1–8.

8. Richardson AR, Libby SJ, Fang FC. 2008. A Nitric Oxide-Inducible Lactate Dehydrogenase Enables Staphylococcus aureus to Resist Innate Immunity. Science 319:1672–1676.

Download 121.65 Kb.

Share with your friends:




The database is protected by copyright ©ininet.org 2023
send message

    Main page